The Open Orthopaedics Journal




ISSN: 1874-3250 ― Volume 13, 2019

Expressional Analysis of GFP-Tagged Cells in an In Vivo Mouse Model of Giant Cell Tumor of Bone



S Singh, M Singh, I Mak, M Ghert*
Department of Surgery, McMaster University, Hamilton, Ontario, Canada

Abstract

Giant cell tumor of bone in a neoplastic stromal cell which survives for multiple passages in primary cell culture with a stable phenotype. In the pathological environment of GCT, the neoplastic nature of the mesenchymal stromal component drives local hematopoietic precursors to undergo fusion and form multinucleated osteoclast like giant cells. There is currently very limited knowledge about the pathogenesis of GCT due to the lack of suitable in vivo models for this tumor. Here we report stable gene transfer of Green fluorescence protein (GFP) in GCT stromal cells. In the present study, we have used GCT stromal cells that stably express enhanced green fluorescence protein (GFP) that are used in a new in vivo culture model. Our results show the utility of the GFP tagged cell lines that stably express GFP signals up to 52 weeks of continuous growth. The in vivo model described herein can serve as an excellent system for in vivo therapeutic and mechanistic evaluation of existing and novel targets for GCT.

Keywords: Green fluorescence protein, giant cell tumor, transfection.


Article Information


Identifiers and Pagination:

Year: 2013
Volume: 7
First Page: 109
Last Page: 113
Publisher Id: TOORTHJ-7-109
DOI: 10.2174/1874325001307010109

Article History:

Received Date: 12/8/2012
Revision Received Date: 12/3/2013
Acceptance Date: 12/3/2013
Electronic publication date: 3/5/2013
Collection year: 2013

Article Metrics:

CrossRef Citations:
0

Total Statistics:

Full-Text HTML Views: 1631
Abstract HTML Views: 1066
PDF Downloads: 311
Total Views/Downloads: 3008

Unique Statistics:

Full-Text HTML Views: 875
Abstract HTML Views: 611
PDF Downloads: 199
Total Views/Downloads: 1685
Geographical View

© Singh et al.; Licensee Bentham Open.

open-access license: This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.5/) which permits unrestrictive use, distribution, and reproduction in any medium, provided the original work is properly cited.


* Address correspondence to this author at the Department of Surgery, McMaster University, 699 Concession Street, Hamilton, ON, L8V 5C2, Canada; Tel: +1 905 387 9495, Ext. 64089; Fax: +1 905 381-3031; E-mail: michelle.ghert@jcc.hhsc.ca





INTRODUCTION

Giant cell tumor of bone (GCT) is an aggressive tumor of bone characterized by presence of multinucleated giant cells which occasionally metastasis to lungs. It typically affects the epiphyseal regions of the long bones such as the distal femur, the proximal tibia, and the distal radius, prompting the formation of a local osteolytic lesion [1Boons HW, Keijser LC, Schreuder HW, Pruszczynski M, Lemmens JA, Veth RP. Oncologic and functional results after treatment of giant cell tumors of bone Arch Orthop Trauma Surg 2002; 122: 17-23.-7Turcotte RE, Ferrone M, Isler MH, Wong C. Outcomes in patients with popliteal sarcomas Can J Surg 2009; 52: 51-.]. There is currently no effective curative treatment for GCT other than aggressive surgical resection [8Bini SA, Gill K, Johnston JO. Giant cell tumor of bone. Curettage and cement reconstruction Clin Orthop Relat Res 1995; 245-50.-11Ghert MA, Rizzo M, Harrelson JM, Scully SP. Giant-cell tumor of the appendicular skeleton Clin Orthop Relat Res 2002; (400): 201-10.].

Metastasis, with identical morphology to the primary tumor, occurs in a few percent of cases, usually to the lung [12Dominkus M, Ruggieri P, Bertoni F, et al. Histologically verified lung metastases in benign giant cell tumours--14 cases from a single institution Int Orthop 2006; 30: 499-504.-14Ghert MA, Simunovic N, Cowan RW, Colterjohn N, Singh G. Properties of the stromal cell in giant cell tumor of bone Clin Orthop Relat Res 2007; 459: 8-13.]. There is a need for clinically relevant in vivo models to study the molecular and cellular mechanisms underlying metastatic behavior. The major obstacle to the treatment of GCT is the lack of effective pre-and post-operative adjuvant therapy and the lack of an animal model that accurately reflects the pathophysiology of human GCT.

The aim of this study was to develop a clinically relevant in vivo model using exogenous gene transfer of GFP into the GCT stromal cell which would allow assessment of in vivo response to systemic treatment. Here we report a successfully generated GCT stable cell line and GFP expression in an in vivo mouse model of GCT. This current in vivo mouse model will be beneficial for the clinical prospective to characterize the systemic therapeutic targets in GCT and to understand the pathobiology of GCT.

MATERIAL AND METHODS

Primary Cell Line Culture and Transfection

GCT cell culture and transfection assay were performed as described in our previous study [15Singh S, Mak I, Power P, Cunningham M, Singh G, Ghert M. Gene transfection in primary stem-like cells of giant cell tumor of bone Stem Cells and Cloning: Adv Appl 2010; 3: 129-34.]. Briefly, GCT stromal primary cells were obtained from fresh tissue of GCT patient following Ethics Board approval and patient consent. The GCT tissue was processed and cell suspension was cultured in DMEM containing glutamine and supplemented 10% fetal bovine serum, 1% penicillin/streptomycin. After several successive passages, the multinucleated giant cells were eliminated from the culture and only mesenchymal stromal cells remains in the culture. Cells transfection was carried out in e-GFP vector using electroporation method [15Singh S, Mak I, Power P, Cunningham M, Singh G, Ghert M. Gene transfection in primary stem-like cells of giant cell tumor of bone Stem Cells and Cloning: Adv Appl 2010; 3: 129-34.].

PCR Detection

Total RNA extraction was performed by TRIZOL Reagent (Sigma) according to the manufacturer’s protocol. The resuspended RNA samples were treated with ribonuclease A (RNase A)-free DNaseI for 1h at 37°C to remove residual genomic DNA. One microgram of total RNA was incubated with 2 ml primer cocktail at 68ºC and subjected to reverse transcription (RT) using Superscript III reverse transcriptase (Invitrogen) for cDNA synthesis. An aliquot of 5 μl of the reverse transcription reaction was used in a 50-μl PCR reaction. GFP signals were detected by PCR analysis using GFP (F). AAGTTCATCTGCACCACCG and GFP (R) TCCTTGAAGAAGATGGTGCG primers, respectively. The PCR conditions were 94°C denaturation for 3 min followed by 40 cycles of 94°C for 30 sec, 55°C for 40 sec, and 72°C for 50 sec. The RT-PCR products were separated on a 2% agarose gel. A 300-bp band represented the eGFP mRNA, and a 250-bp band indicated β-actin as internal control.

Protein Extraction and Western Blot

Cytoplasmic fractions were isolated from GFP-transfected cells by scraping after 24 h of incubation and then centrifuged for 5 min. The cells were lysed with NP-40 containing lysis buffer (10 mM Tris, pH 7.4, 10 mM NaCl, 5mM MgCl2, 0.5% NP-40) to disrupt the cell membrane and then the cell lysate was centrifuged at 500 × g for 5 min at 4°C. The supernatant (cytoplasmic fraction) was removed. Proteins were denatured by boiling in sample buffer, separated on 12% SDSPAGE and then transferred onto the PVDF membrane (Immobilon TM-PSQ, Millipore) and blocked overnight in 5% non-fat powdered milk in TBST (10 mM Tris-HCl pH7.5,100 mM NaCl, 0.1% (v/v) tween-20). Mouse monoclonal anti-GFP antibody (1:1000 diluted in TBST) (Abcam) was used for protein detection. Peroxidase conjugated goat anti-mouse IgG (1:5,000 diluted in TBST) (Sigma, Missouri, USA) was used as a secondary antibody.

In Vivo GFP Expression

Suspensions were made of one of the GFP-transfected GCT cells prior to injection in phosphate-buffered saline. Injections were prepared using 1cc syringes fitted with 27-ga needle and drawing up 0.01 mL of injectate, corresponding to a total of 105-106 cells per injection. 6-7 week old female Balb/c nu/nu mice were anaesthetized using gaseous isoflurane and injected into the sub-periosteum of the right tibia. The left tibia was injected with PBS to act as an internal negative control. Mice were monitored weekly for the presence of tumors, and then 2-3 times weekly when tumor growth was noticed. The mice were sacrificed at day 8 and 35 post-injection and stored in formalin. Both lower limbs and any tumours were then removed for further analysis. Both limbs were decalcified for two weeks (TBD-2 Decalcifier, Thermo Scientific) and processed (Shandon Citadel 2000 Tissue Processor). Decalcified limbs were embedded in paraffin wax, cross-sectioned and mounted to microscope slides.

Immunofluorescence Assays

Immunofluoresence assays were conducted according to standard protocols used by singh et al. 2010. Briefly, culture chamber slides containing the GFP-transfected GCT cells as well as slides of the sectioned tissues were first fixed in paraformaldehyde and the cells were permeabilized with Triton X-100. After blocking slides with BSA, these slides were incubated for 1h at 37°C with the rabbit polyclonal anti-GFP primary antibody (1:250 dilutions; Abcam, Cambridge, MA). Slides were further incubated in secondary antibody Texas Red conjugated goat anti-rabbit IgG (1:1000 dilutions; Invitrogen) for 1h at room temperature. The slides were washed and incubated with DAPI for three minutes and then mounted using glycerol.

RESULTS

Transfection Efficiency of eGFP in GCT Stromal Cells

GCT stromal cells were transfected with eGFP-C1 construct using an electroporation method. To determine the cellular localization of green fluorescence protein, transfected cells were counted under fluorescence microscopy. GFP expressions were detected in successfully transfected GCT stromal cells cytoplasm and in the nucleus (Fig. 1a). The expression of GFP in GCT stromal cells was validated by semi-quantitative PCR using GFP specific primers and Western blot analysis. We observed GFP expression in transfected cells, but not in untransfected GCT stromal cells by semi-quatitative PCR (Fig. 1b) and confirmed GFP expression in Western blot analysis using an anti-GFP antibody (Fig. 1c).

Fig. (1)

Subcellular localization of GFP signals in GCT transfected stromal cells. GFP signals were detected by immune-fluorescence. (b) Semi-quantitative PCR: GFP expression in transfected GCT stromal cells was detected using GFP specific primers and GAPDH was used as an internal control. UT=untrasnfected cells and GCTT= GCT transfected cells. (c) These results are verified at the protein level by western blot analysis.



Generation of Stable GCT Stromal Cells

A highly invasive and spontaneously metastatic GCT human cell line was transfected with the enhanced green fluorescent protein (GFP) as previously described and treated with cell media containing 1µg/ml G418 (Invitrogen). Positive GFP transfected cells were selected under fluorescence microscope, transferred and subcultured with G418 media. Stable expression of GFP in GCT stromal cells was confirmed in cells cultured in vitro up to 52 weeks of continuous growth. These results show the in vitro utility of the GCT stromal cell lines that stably express high levels of GFP (Fig. 2).

Fig. (2)

Detection of GFP signals after 52 weeks. Stable expression of GFP was confirmed in cells cultured in vitro up to 52 weeks of continuous growth. GFP expression was detected under fluorescence microscopy. DAPI (blue) staining indicated the nuclei.



Expressional Analysis of GFP Tagged GCT Stromal Cells In Vivo

Balb/c nu/nu mice 6-7 weeks old female were used for this study and 100µl of injectate corresponding to 0.5x106-1.5x106 GFP-transfected GCT cells was injected into the sub-periosteum of the right tibia. The left tibia was injected with PBS to act as an internal control. Mice were monitored weekly for 5 weeks. The mice were sacrificed at day 8 or day 35 post-injection and stored in formalin. Both lower limbs were then removed for further analysis. We observed GFP expression in the injected limbs on days 8 and 35 (Fig. 3).

Fig. (3)

In vivo observation of GFP signals. We observed in vivo GFP expression on days 8 and 35 post injection in the subperiosteal region of the tibia of immunocompromised mice. No GFP signals were detected in tissue from the control contralateral leg.



DISCUSSION

Tumor progression and invasion is a complex biological process that involves remodeling of stromal tissue by invading cells. Giant cell tumors are normally benign with unpredictable behavior [16Werner M. Giant cell tumour of bone: morphological, biological and histogenetical aspects Int Orthop 2006; 30: 484-9.,17Dickson BC, Li SQ, Wunder JS, et al. Giant cell tumor of bone express p63 Mod Pathol 2008; 21: 369-75.]. Although classified as a benign tumor of bone, GCT has been reported to metastasize to the lungs up to 5% of cases and in rare instances (1-3%) can be transformed to the malignant sarcoma phenotype with equal disease outcome [17Dickson BC, Li SQ, Wunder JS, et al. Giant cell tumor of bone express p63 Mod Pathol 2008; 21: 369-75.-19Grigolo B, Roseti L, Neri S, et al. Human articular chondrocytes immortalized by HPV-16 E6 and E7 genes: Maintenance of differentiated phenotype under defined culture conditions Osteoarthr Cartil 2002; 10: 879-9.]. The pathobiology of GCT is poorly elucidated due to lack of a GCT stable cell line and animal model to study tumor growth and physiology. We describe the generation and the utilization of a GCT cell line that stably expresses GFP both in vitro and in vivo.

GCT mesenchymal stromal cells became the homogeneous cell type whereas the multinucleated giant cells were eliminated from culture and maintained the phenotype up to the tenth passage were used for experiments [19Grigolo B, Roseti L, Neri S, et al. Human articular chondrocytes immortalized by HPV-16 E6 and E7 genes: Maintenance of differentiated phenotype under defined culture conditions Osteoarthr Cartil 2002; 10: 879-9., 20Kashiwagi Y, Nishitsuka K, Namba H, Kamiryo M, Takamura H, Yamashita H. Cloning and characterization of cell strains derived from human corneal stroma and sclera Jpn J Ophthalmol 2010; 54: 74-80.]. Here, we are describing gene transfer and stable cells generation in patient-derived primary GCT stromal cells. We were able to generate a stable GFP-tagged GCT cell line by an electroporation method. We detected GFP signals using fluorescence microscopy and western blot analysis at 52 weeks post transfection. Furthermore, we used this stable cell line in an in vivo mouse model and observed GFP signals by immunofluorescence microscopy after 8 and 35 days post-injection.

This model is the first described for GCT in which in vivo tracking of tumor viability can be successfully accomplished. Recently, a short-term in vivo model of GCT was reported using chick chorioallantoic membrane (CAM). This model was used to observe the dissemination of tumor cells along vessels leading away from the tumor [21Balke M, Neumann A, Szuhai K, et al. A short-term in vivo model for giant cell tumor of bone BMC Cancer 2011; 11: 241.]. GFP tagged GCT cells in an in vivo murine model would be a further step towards generation of a more physiologic in vivo model that could identify targets for systemic therapy in GCT.

In conclusion, we report stable gene transfection in GCT stromal cells that can survive and be visualized in vivo. The stable GCT stromal cell line described herein can serve as an excellent system for in vitro and in vivo therapeutic and mechanistic evaluation of molecular approaches to the clinical management of GCT.

CONFLICT OF INTEREST

The authors confirm that this article content has no conflict of interest.

ACKNOWLEDGEMENTS

We would like to thank these following funding sources: Canadian Institutes of Health Research (CIHR) Grant, Hamilton Health Science New Investigator Fund, Hamilton Health Science Early Career Award, Juravinski Cancer Centre Foundation Grant, and McMaster University Surgical Associates Grant. The funders had no role in study design, data collect ion and analysis, decision to publish, or preparation of the manuscript.

REFERENCES

[1] Boons HW, Keijser LC, Schreuder HW, Pruszczynski M, Lemmens JA, Veth RP. Oncologic and functional results after treatment of giant cell tumors of bone Arch Orthop Trauma Surg 2002; 122: 17-23.
[2] Ghert M, Alsaleh K, Farrokhyar F, Colterjohn N. Outcomes of an anatomically based approach to metastatic disease of the acetabulum Clin Orthop Relat Res 2007; 459: 122-7.
[3] Goldring SR, Schiller AL, Mankin HJ, Dayer JM, Krane SM. Characterization of cells from human giant cell tumors of bone Clin Orthop Relat Res 1986; (204): 59-75.
[4] Katz E, Nyska M, Okon E, Zajicek G, Robin G. Growth rate analysis of lung metastases from histologically benign giant cell tumor of bone Cancer 1987; 59: 1831-6.
[5] McDonald DJ, Sim FH, McLeod RA, Dahlin DC. Giant-cell tumor of bone J Bone Joint Surg Am 1986; 68: 235-42.
[6] Oda Y, Miura H, Tsuneyoshi M, Iwamoto Y. Giant cell tumor of bone: oncological and functional results of long-term follow-up Jpn J Clin Oncol 1998; 28: 323-8.
[7] Turcotte RE, Ferrone M, Isler MH, Wong C. Outcomes in patients with popliteal sarcomas Can J Surg 2009; 52: 51-.
[8] Bini SA, Gill K, Johnston JO. Giant cell tumor of bone. Curettage and cement reconstruction Clin Orthop Relat Res 1995; 245-50.
[9] Blackley HR, Wunder JS, Davis AM, White LM, Kandel R, Bell RS. Treatment of giant-cell tumors of long bones with curettage and bone-grafting J Bone Joint Surg Am 1999; 81: 811-20.
[10] Capanna R, Fabbri N, Bettelli G. Curettage of giant cell tumor of bone. The effect of surgical technique and adjuvants on local recurrence rate Chir Organi Mov 1990; 75: 206.
[11] Ghert MA, Rizzo M, Harrelson JM, Scully SP. Giant-cell tumor of the appendicular skeleton Clin Orthop Relat Res 2002; (400): 201-10.
[12] Dominkus M, Ruggieri P, Bertoni F, et al. Histologically verified lung metastases in benign giant cell tumours--14 cases from a single institution Int Orthop 2006; 30: 499-504.
[13] Dominkus M, Darwish E, Funovics P. Reconstruction of the pelvis after resection of malignant bone tumours in children and adolescents Recent Results Cancer Res 2009; 179: 85-111.
[14] Ghert MA, Simunovic N, Cowan RW, Colterjohn N, Singh G. Properties of the stromal cell in giant cell tumor of bone Clin Orthop Relat Res 2007; 459: 8-13.
[15] Singh S, Mak I, Power P, Cunningham M, Singh G, Ghert M. Gene transfection in primary stem-like cells of giant cell tumor of bone Stem Cells and Cloning: Adv Appl 2010; 3: 129-34.
[16] Werner M. Giant cell tumour of bone: morphological, biological and histogenetical aspects Int Orthop 2006; 30: 484-9.
[17] Dickson BC, Li SQ, Wunder JS, et al. Giant cell tumor of bone express p63 Mod Pathol 2008; 21: 369-75.
[18] Thomas DM, Skubitz KM. Giant cell tumour of bone Curr Opin Oncol 2009; 21: 338-44.
[19] Grigolo B, Roseti L, Neri S, et al. Human articular chondrocytes immortalized by HPV-16 E6 and E7 genes: Maintenance of differentiated phenotype under defined culture conditions Osteoarthr Cartil 2002; 10: 879-9.
[20] Kashiwagi Y, Nishitsuka K, Namba H, Kamiryo M, Takamura H, Yamashita H. Cloning and characterization of cell strains derived from human corneal stroma and sclera Jpn J Ophthalmol 2010; 54: 74-80.
[21] Balke M, Neumann A, Szuhai K, et al. A short-term in vivo model for giant cell tumor of bone BMC Cancer 2011; 11: 241.

Endorsements



"Open access will revolutionize 21st century knowledge work and accelerate the diffusion of ideas and evidence that support just in time learning and the evolution of thinking in a number of disciplines."


Daniel Pesut
(Indiana University School of Nursing, USA)

"It is important that students and researchers from all over the world can have easy access to relevant, high-standard and timely scientific information. This is exactly what Open Access Journals provide and this is the reason why I support this endeavor."


Jacques Descotes
(Centre Antipoison-Centre de Pharmacovigilance, France)

"Publishing research articles is the key for future scientific progress. Open Access publishing is therefore of utmost importance for wider dissemination of information, and will help serving the best interest of the scientific community."


Patrice Talaga
(UCB S.A., Belgium)

"Open access journals are a novel concept in the medical literature. They offer accessible information to a wide variety of individuals, including physicians, medical students, clinical investigators, and the general public. They are an outstanding source of medical and scientific information."


Jeffrey M. Weinberg
(St. Luke's-Roosevelt Hospital Center, USA)

"Open access journals are extremely useful for graduate students, investigators and all other interested persons to read important scientific articles and subscribe scientific journals. Indeed, the research articles span a wide range of area and of high quality. This is specially a must for researchers belonging to institutions with limited library facility and funding to subscribe scientific journals."


Debomoy K. Lahiri
(Indiana University School of Medicine, USA)

"Open access journals represent a major break-through in publishing. They provide easy access to the latest research on a wide variety of issues. Relevant and timely articles are made available in a fraction of the time taken by more conventional publishers. Articles are of uniformly high quality and written by the world's leading authorities."


Robert Looney
(Naval Postgraduate School, USA)

"Open access journals have transformed the way scientific data is published and disseminated: particularly, whilst ensuring a high quality standard and transparency in the editorial process, they have increased the access to the scientific literature by those researchers that have limited library support or that are working on small budgets."


Richard Reithinger
(Westat, USA)

"Not only do open access journals greatly improve the access to high quality information for scientists in the developing world, it also provides extra exposure for our papers."


J. Ferwerda
(University of Oxford, UK)

"Open Access 'Chemistry' Journals allow the dissemination of knowledge at your finger tips without paying for the scientific content."


Sean L. Kitson
(Almac Sciences, Northern Ireland)

"In principle, all scientific journals should have open access, as should be science itself. Open access journals are very helpful for students, researchers and the general public including people from institutions which do not have library or cannot afford to subscribe scientific journals. The articles are high standard and cover a wide area."


Hubert Wolterbeek
(Delft University of Technology, The Netherlands)

"The widest possible diffusion of information is critical for the advancement of science. In this perspective, open access journals are instrumental in fostering researches and achievements."


Alessandro Laviano
(Sapienza - University of Rome, Italy)

"Open access journals are very useful for all scientists as they can have quick information in the different fields of science."


Philippe Hernigou
(Paris University, France)

"There are many scientists who can not afford the rather expensive subscriptions to scientific journals. Open access journals offer a good alternative for free access to good quality scientific information."


Fidel Toldrá
(Instituto de Agroquimica y Tecnologia de Alimentos, Spain)

"Open access journals have become a fundamental tool for students, researchers, patients and the general public. Many people from institutions which do not have library or cannot afford to subscribe scientific journals benefit of them on a daily basis. The articles are among the best and cover most scientific areas."


M. Bendandi
(University Clinic of Navarre, Spain)

"These journals provide researchers with a platform for rapid, open access scientific communication. The articles are of high quality and broad scope."


Peter Chiba
(University of Vienna, Austria)

"Open access journals are probably one of the most important contributions to promote and diffuse science worldwide."


Jaime Sampaio
(University of Trás-os-Montes e Alto Douro, Portugal)

"Open access journals make up a new and rather revolutionary way to scientific publication. This option opens several quite interesting possibilities to disseminate openly and freely new knowledge and even to facilitate interpersonal communication among scientists."


Eduardo A. Castro
(INIFTA, Argentina)

"Open access journals are freely available online throughout the world, for you to read, download, copy, distribute, and use. The articles published in the open access journals are high quality and cover a wide range of fields."


Kenji Hashimoto
(Chiba University, Japan)

"Open Access journals offer an innovative and efficient way of publication for academics and professionals in a wide range of disciplines. The papers published are of high quality after rigorous peer review and they are Indexed in: major international databases. I read Open Access journals to keep abreast of the recent development in my field of study."


Daniel Shek
(Chinese University of Hong Kong, Hong Kong)

"It is a modern trend for publishers to establish open access journals. Researchers, faculty members, and students will be greatly benefited by the new journals of Bentham Science Publishers Ltd. in this category."


Jih Ru Hwu
(National Central University, Taiwan)


Browse Contents




Webmaster Contact: info@benthamopen.net
Copyright © 2019 Bentham Open